|
OriGene
bcl2l1 Bcl2l1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm41799195-157-53-67?v=OriGene Average 94 stars, based on 1 article reviews
bcl2l1 - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
oligo dt primer Oligo Dt Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm41402350-316-33-40?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
oligo dt primer - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
ATCC
hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer Hb 8065 Ampk Dko Mefs X Jiang Lab N A Oligonucleotides Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm40906557-252-72-66?v=ATCC Average 99 stars, based on 1 article reviews
hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Qiagen
primers 249900 Primers 249900, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/10__1016_slash_j__omtn__2025__102644-212-19-17?v=Qiagen Average 99 stars, based on 1 article reviews
primers 249900 - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
Illumina Inc
ts primer-x Ts Primer X, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm40179877-1267-7-18?v=Illumina+Inc Average 90 stars, based on 1 article reviews
ts primer-x - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Qiagen
pre prepared primer assay Pre Prepared Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/10__21608_slash_muj__2025__366265__1211-77-31-35?v=Qiagen Average 96 stars, based on 1 article reviews
pre prepared primer assay - by Bioz Stars,
2026-08
96/100 stars
|
Buy from Supplier |
|
Premier Biosoft
primer premier 5.0 x software Primer Premier 5.0 X Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm40068753-59-14-30?v=Premier+Biosoft Average 90 stars, based on 1 article reviews
primer premier 5.0 x software - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
TaKaRa
3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat 3 Forward Primer 3 5 Reverse Primer Mir 146a 5p Mi0000477 Mirbase Tgagaactgaattccatgggtt Takara Bio Cat, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm39967042-123-3-13?v=TaKaRa Average 97 stars, based on 1 article reviews
3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |
|
Thermo Fisher
x sbe primers X Sbe Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm39983295-56-53-61?v=Thermo+Fisher Average 99 stars, based on 1 article reviews
x sbe primers - by Bioz Stars,
2026-08
99/100 stars
|
Buy from Supplier |
|
TaKaRa
mrq 3 primers Mrq 3 Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+x/pm39788477-94-17-26?v=TaKaRa Average 97 stars, based on 1 article reviews
mrq 3 primers - by Bioz Stars,
2026-08
97/100 stars
|
Buy from Supplier |