Review





Similar Products

94
OriGene bcl2l1
Bcl2l1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm41799195-157-53-67?v=OriGene
Average 94 stars, based on 1 article reviews
bcl2l1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

99
Thermo Fisher oligo dt primer
Oligo Dt Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm41402350-316-33-40?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
oligo dt primer - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
ATCC hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer
Hb 8065 Ampk Dko Mefs X Jiang Lab N A Oligonucleotides Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm40906557-252-72-66?v=ATCC
Average 99 stars, based on 1 article reviews
hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

99
Qiagen primers 249900
Primers 249900, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/10__1016_slash_j__omtn__2025__102644-212-19-17?v=Qiagen
Average 99 stars, based on 1 article reviews
primers 249900 - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

90
Illumina Inc ts primer-x
Ts Primer X, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm40179877-1267-7-18?v=Illumina+Inc
Average 90 stars, based on 1 article reviews
ts primer-x - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

96
Qiagen pre prepared primer assay
Pre Prepared Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/10__21608_slash_muj__2025__366265__1211-77-31-35?v=Qiagen
Average 96 stars, based on 1 article reviews
pre prepared primer assay - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Premier Biosoft primer premier 5.0 x software
Primer Premier 5.0 X Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm40068753-59-14-30?v=Premier+Biosoft
Average 90 stars, based on 1 article reviews
primer premier 5.0 x software - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

97
TaKaRa 3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat
3 Forward Primer 3 5 Reverse Primer Mir 146a 5p Mi0000477 Mirbase Tgagaactgaattccatgggtt Takara Bio Cat, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm39967042-123-3-13?v=TaKaRa
Average 97 stars, based on 1 article reviews
3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

99
Thermo Fisher x sbe primers
X Sbe Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm39983295-56-53-61?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
x sbe primers - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

97
TaKaRa mrq 3 primers
Mrq 3 Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+x/pm39788477-94-17-26?v=TaKaRa
Average 97 stars, based on 1 article reviews
mrq 3 primers - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier

Image Search Results